Review



par3 sirna  (Santa Cruz Biotechnology)


Bioz Verified Symbol Santa Cruz Biotechnology is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 92

    Structured Review

    Santa Cruz Biotechnology par3 sirna
    Par3 Sirna, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 92/100, based on 4 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/par3+sirna/PAR-3+siRNA/us12000825-94-3-8
    Average 92 stars, based on 4 article reviews
    par3 sirna - by Bioz Stars, 2026-09
    92/100 stars

    Images

    Related Articles

    Control:

    Article Title: Method of selecting stem cells having ability to produce extracellular vesicles with high efficiency using activation of protease-activated receptor-mediated signaling pathways
    Article Snippet: .. Control siRNA and PAR3 siRNA were purchased from Santa Cruz Biotechnology (Santa Cruz, CA, USA). ..



    Similar Products

    92
    Santa Cruz Biotechnology par3 sirna
    Par3 Sirna, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/par3+sirna/PAR-3+siRNA/us12000825-94-3-8
    Average 92 stars, based on 1 article reviews
    par3 sirna - by Bioz Stars, 2026-09
    92/100 stars
      Buy from Supplier

    90
    Ribobio co par3-sirna
    Par3 Sirna, supplied by Ribobio co, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/par3+sirna/primer+par1+anti+sense/pmc09137112-114-11-12
    Average 90 stars, based on 1 article reviews
    par3-sirna - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    92
    Santa Cruz Biotechnology par3 sirnas
    Expression of protease-activated receptors. After thrombin preconditioning (2 U) for 6 h, umbilical cord-derived mesenchymal stem cells (UCB-MSCs) were lysed and subjected to immunoblotting analysis with the indicated antibodies. ( A ) Immunoblot analysis of the expression of protease-activated receptors (PARs) in UCB-MSCs. After thrombin preconditioning, the levels of PARs in the UCB-MSCs were determined by immunoblotting analysis. ( B ) Bar graph showing quantification of the amounts of each PAR. ( C ) Lysates from UCB-MSCs treated with the indicated <t>siRNAs</t> for 24 h were subjected to immunoblot analysis. Cell lysates were analyzed by immunoblotting, and the protein levels were normalized to GAPDH. An asterisk (*) indicates a significant difference vs. naive EVs.
    Par3 Sirnas, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/par3+sirna/PAR-3+siRNA/pmc06627943-98-2-7
    Average 92 stars, based on 1 article reviews
    par3 sirnas - by Bioz Stars, 2026-09
    92/100 stars
      Buy from Supplier

    90
    Shanghai GenePharma par3 sirna duplexes
    <t>Par3</t> expression affects YAP subcellular translocation in MDCK cells. ( a ) Distribution and co-localization of YAP (red), Par3 (green), a merged image with only YAP and Par3 and a merged image with 4′, 6-diamidino-2-phenylindole (blue) of MDCK II cells at different cell densities. Scale bar: 25 μm. ( b ) Ratios of the percentages of nuclear and cytoplasmic YAP and Par3 at different cell densities are shown. Pictures were analyzed with a Columbus Image Data Storage and Analysis System. ( c ) Representative images of YAP translocation into the cytoplasm at low cell density when Par3 was knocked down but not at high cell density. MDCK II cells were transfected with <t>siRNA</t> for Par3 at different cell densities. YAP (red), Par3 (green) and a merged image. Scale bar: 25 μm. All pictures were taken with a Leica TCS SP5 microscope. ( d ) The areas representing the cytosolic or nuclear fraction are indicated with bars at the top of each histogram. N: nucleus; C: cytoplasm. The histogram analysis of YAP and Par3 signal intensity in subcellular distributions was performed with the ‘Plot profile’ in ImageJ software. The analyzed area is indicated by the white straight line in the overview. YAP signal intensity distribution (red line), nucleus signal intensity distribution (blue line). ( e , f ) YAP translocated into the nucleus with Par3 overexpression, and YAP nuclear localization was inhibited when Par3 was knocked down. A cell fraction assay was performed after 293T cells were transfected with Flag-Par3 or MDCK II cells were transfected with siRNA for Par3 for 2 days at low cell density. Lamin-B is the nuclear marker and β-actin is the cytoplasmic marker. ( g ) Par3 knockdown reduced YAP translocation to the nucleus in the Ca 2+ off switch system. Representative images of YAP translocation into the nucleus at high cell density when Ca 2+ was depleted are shown. After 2 days, while MDCK II cells were transfected with siRNA for Par3, MDCK II cells were cultured with Ca 2+ -free medium for the indicated time course. YAP (red), Par3 (green) and ZO-1 (purple). Scale bar: 25 μm. ( h ) Ratios of the percentages of nuclear and cytoplasmic YAP and Par3 at different time points. Pictures were analyzed with a Columbus Image Data Storage and Analysis System. ** P <0.01, * P <0.05.
    Par3 Sirna Duplexes, supplied by Shanghai GenePharma, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/par3+sirna/double+stranded+oligonucleotides+targeting+against+par3/pmc04932730-213-4-29
    Average 90 stars, based on 1 article reviews
    par3 sirna duplexes - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    92
    Santa Cruz Biotechnology sirna against par3
    <t>Par3</t> expression affects YAP subcellular translocation in MDCK cells. ( a ) Distribution and co-localization of YAP (red), Par3 (green), a merged image with only YAP and Par3 and a merged image with 4′, 6-diamidino-2-phenylindole (blue) of MDCK II cells at different cell densities. Scale bar: 25 μm. ( b ) Ratios of the percentages of nuclear and cytoplasmic YAP and Par3 at different cell densities are shown. Pictures were analyzed with a Columbus Image Data Storage and Analysis System. ( c ) Representative images of YAP translocation into the cytoplasm at low cell density when Par3 was knocked down but not at high cell density. MDCK II cells were transfected with <t>siRNA</t> for Par3 at different cell densities. YAP (red), Par3 (green) and a merged image. Scale bar: 25 μm. All pictures were taken with a Leica TCS SP5 microscope. ( d ) The areas representing the cytosolic or nuclear fraction are indicated with bars at the top of each histogram. N: nucleus; C: cytoplasm. The histogram analysis of YAP and Par3 signal intensity in subcellular distributions was performed with the ‘Plot profile’ in ImageJ software. The analyzed area is indicated by the white straight line in the overview. YAP signal intensity distribution (red line), nucleus signal intensity distribution (blue line). ( e , f ) YAP translocated into the nucleus with Par3 overexpression, and YAP nuclear localization was inhibited when Par3 was knocked down. A cell fraction assay was performed after 293T cells were transfected with Flag-Par3 or MDCK II cells were transfected with siRNA for Par3 for 2 days at low cell density. Lamin-B is the nuclear marker and β-actin is the cytoplasmic marker. ( g ) Par3 knockdown reduced YAP translocation to the nucleus in the Ca 2+ off switch system. Representative images of YAP translocation into the nucleus at high cell density when Ca 2+ was depleted are shown. After 2 days, while MDCK II cells were transfected with siRNA for Par3, MDCK II cells were cultured with Ca 2+ -free medium for the indicated time course. YAP (red), Par3 (green) and ZO-1 (purple). Scale bar: 25 μm. ( h ) Ratios of the percentages of nuclear and cytoplasmic YAP and Par3 at different time points. Pictures were analyzed with a Columbus Image Data Storage and Analysis System. ** P <0.01, * P <0.05.
    Sirna Against Par3, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/par3+sirna/PAR-3+siRNA/pm18062909-35-29-37
    Average 92 stars, based on 1 article reviews
    sirna against par3 - by Bioz Stars, 2026-09
    92/100 stars
      Buy from Supplier

    90
    Genechem par3 sirna duplexes
    <t>Par3</t> expression affects YAP subcellular translocation in MDCK cells. ( a ) Distribution and co-localization of YAP (red), Par3 (green), a merged image with only YAP and Par3 and a merged image with 4′, 6-diamidino-2-phenylindole (blue) of MDCK II cells at different cell densities. Scale bar: 25 μm. ( b ) Ratios of the percentages of nuclear and cytoplasmic YAP and Par3 at different cell densities are shown. Pictures were analyzed with a Columbus Image Data Storage and Analysis System. ( c ) Representative images of YAP translocation into the cytoplasm at low cell density when Par3 was knocked down but not at high cell density. MDCK II cells were transfected with <t>siRNA</t> for Par3 at different cell densities. YAP (red), Par3 (green) and a merged image. Scale bar: 25 μm. All pictures were taken with a Leica TCS SP5 microscope. ( d ) The areas representing the cytosolic or nuclear fraction are indicated with bars at the top of each histogram. N: nucleus; C: cytoplasm. The histogram analysis of YAP and Par3 signal intensity in subcellular distributions was performed with the ‘Plot profile’ in ImageJ software. The analyzed area is indicated by the white straight line in the overview. YAP signal intensity distribution (red line), nucleus signal intensity distribution (blue line). ( e , f ) YAP translocated into the nucleus with Par3 overexpression, and YAP nuclear localization was inhibited when Par3 was knocked down. A cell fraction assay was performed after 293T cells were transfected with Flag-Par3 or MDCK II cells were transfected with siRNA for Par3 for 2 days at low cell density. Lamin-B is the nuclear marker and β-actin is the cytoplasmic marker. ( g ) Par3 knockdown reduced YAP translocation to the nucleus in the Ca 2+ off switch system. Representative images of YAP translocation into the nucleus at high cell density when Ca 2+ was depleted are shown. After 2 days, while MDCK II cells were transfected with siRNA for Par3, MDCK II cells were cultured with Ca 2+ -free medium for the indicated time course. YAP (red), Par3 (green) and ZO-1 (purple). Scale bar: 25 μm. ( h ) Ratios of the percentages of nuclear and cytoplasmic YAP and Par3 at different time points. Pictures were analyzed with a Columbus Image Data Storage and Analysis System. ** P <0.01, * P <0.05.
    Par3 Sirna Duplexes, supplied by Genechem, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/par3+sirna/par3+sirna+duplexes/pm17287830-51-4-32
    Average 90 stars, based on 1 article reviews
    par3 sirna duplexes - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    Image Search Results


    Expression of protease-activated receptors. After thrombin preconditioning (2 U) for 6 h, umbilical cord-derived mesenchymal stem cells (UCB-MSCs) were lysed and subjected to immunoblotting analysis with the indicated antibodies. ( A ) Immunoblot analysis of the expression of protease-activated receptors (PARs) in UCB-MSCs. After thrombin preconditioning, the levels of PARs in the UCB-MSCs were determined by immunoblotting analysis. ( B ) Bar graph showing quantification of the amounts of each PAR. ( C ) Lysates from UCB-MSCs treated with the indicated siRNAs for 24 h were subjected to immunoblot analysis. Cell lysates were analyzed by immunoblotting, and the protein levels were normalized to GAPDH. An asterisk (*) indicates a significant difference vs. naive EVs.

    Journal: International Journal of Molecular Sciences

    Article Title: Thrombin Preconditioning Boosts Biogenesis of Extracellular Vesicles from Mesenchymal Stem Cells and Enriches Their Cargo Contents via Protease-Activated Receptor-Mediated Signaling Pathways

    doi: 10.3390/ijms20122899

    Figure Lengend Snippet: Expression of protease-activated receptors. After thrombin preconditioning (2 U) for 6 h, umbilical cord-derived mesenchymal stem cells (UCB-MSCs) were lysed and subjected to immunoblotting analysis with the indicated antibodies. ( A ) Immunoblot analysis of the expression of protease-activated receptors (PARs) in UCB-MSCs. After thrombin preconditioning, the levels of PARs in the UCB-MSCs were determined by immunoblotting analysis. ( B ) Bar graph showing quantification of the amounts of each PAR. ( C ) Lysates from UCB-MSCs treated with the indicated siRNAs for 24 h were subjected to immunoblot analysis. Cell lysates were analyzed by immunoblotting, and the protein levels were normalized to GAPDH. An asterisk (*) indicates a significant difference vs. naive EVs.

    Article Snippet: Control and PAR3 siRNAs were purchased from Santa Cruz Biotechnology (Santa Cruz, CA, USA).

    Techniques: Expressing, Derivative Assay, Western Blot

    Protease-activated receptors, PAR1 and PAR3, are involved in extracellular vesicle production and phosphorylation of ERK and AKT in umbilical cord-derived mesenchymal stem cells after thrombin preconditioning. Thrombin-preconditioned umbilical cord-derived mesenchymal stem cells (UCB-MSCs) were lysed for immunoblotting analysis with the indicated antibodies. ( A ) After thrombin treatment and inhibition, changes in the protein levels of endosome markers in the UCB-MSCs were assessed by immunoblotting. ( B ) Bar graph showing quantification of Rab-5 and EEA1 levels. ( C ) After thrombin treatment and inhibition, changes in the protein levels of phosphorylated (p)ERK1/2, p AKT, ERK1/2, and AKT in the UCB-MSCs were assessed by immunoblotting. ( D ) Bar graph showing quantification of p ERK1/2 p AKT, ERK1/2, and AKT. ( E ) After thrombin treatment and inhibition, changes in the levels of endosome markers in the UCB-MSCs were determined by immunoblotting. ( F ) Bar graph showing quantification of Rab-5 and EEA1 levels. ( G ) After thrombin treatment, changes in the expression of p ERK1/2 and p AKT in the UCB-MSCs were determined by immunoblotting. ( H ) Bar graph showing quantification of p ERK1/2 and p AKT levels. ( I ) Bar graph showing quantification of the ratio of p ERK/ERK and p AKT/AKT. Data are presented as mean ± SD. An asterisk (*) indicates a significant difference vs. naive EVs, a number sign (#) indicates a significant difference vs. thrombin-treated UCB-MSC and, a dollar sign ($) indicates a significant difference vs. thrombin + PAR3 siRNA UCB-MSCs ( p < 0.05, two-sample t -test; n = 5 per analysis).

    Journal: International Journal of Molecular Sciences

    Article Title: Thrombin Preconditioning Boosts Biogenesis of Extracellular Vesicles from Mesenchymal Stem Cells and Enriches Their Cargo Contents via Protease-Activated Receptor-Mediated Signaling Pathways

    doi: 10.3390/ijms20122899

    Figure Lengend Snippet: Protease-activated receptors, PAR1 and PAR3, are involved in extracellular vesicle production and phosphorylation of ERK and AKT in umbilical cord-derived mesenchymal stem cells after thrombin preconditioning. Thrombin-preconditioned umbilical cord-derived mesenchymal stem cells (UCB-MSCs) were lysed for immunoblotting analysis with the indicated antibodies. ( A ) After thrombin treatment and inhibition, changes in the protein levels of endosome markers in the UCB-MSCs were assessed by immunoblotting. ( B ) Bar graph showing quantification of Rab-5 and EEA1 levels. ( C ) After thrombin treatment and inhibition, changes in the protein levels of phosphorylated (p)ERK1/2, p AKT, ERK1/2, and AKT in the UCB-MSCs were assessed by immunoblotting. ( D ) Bar graph showing quantification of p ERK1/2 p AKT, ERK1/2, and AKT. ( E ) After thrombin treatment and inhibition, changes in the levels of endosome markers in the UCB-MSCs were determined by immunoblotting. ( F ) Bar graph showing quantification of Rab-5 and EEA1 levels. ( G ) After thrombin treatment, changes in the expression of p ERK1/2 and p AKT in the UCB-MSCs were determined by immunoblotting. ( H ) Bar graph showing quantification of p ERK1/2 and p AKT levels. ( I ) Bar graph showing quantification of the ratio of p ERK/ERK and p AKT/AKT. Data are presented as mean ± SD. An asterisk (*) indicates a significant difference vs. naive EVs, a number sign (#) indicates a significant difference vs. thrombin-treated UCB-MSC and, a dollar sign ($) indicates a significant difference vs. thrombin + PAR3 siRNA UCB-MSCs ( p < 0.05, two-sample t -test; n = 5 per analysis).

    Article Snippet: Control and PAR3 siRNAs were purchased from Santa Cruz Biotechnology (Santa Cruz, CA, USA).

    Techniques: Phospho-proteomics, Derivative Assay, Western Blot, Inhibition, Expressing

    Protease-activated receptors, PAR1 and PAR3, are involved in endosome production by umbilical cord-derived mesenchymal stem cells and protein cargo contents in extracellular vesicles after thrombin preconditioning. ( A ) After thrombin preconditioning of umbilical cord-derived mesenchymal stem cells (UCB-MSCs), the number of endosomes was determined by labeling early endosomes with green fluorescent protein(GFP-green) and the nuclei with 4′,6-Diamidino-2-Phenylindole, Dihydrochloride (DAPI-blue). ( B ) Bar graph showing the quantified intensities of the endosome-GFP signal. ( C ) After treatment with thrombin and thrombin inhibitor, the number of extracellular vesicles (EVs) was determined using a NanoSightNS300. ( D ) The size and number distribution of EVs as measured and analyzed by Nanoparticle Tracking Analysis software. ( E ) After treatment with thrombin and thrombin inhibitor, the levels of VEGF, angiogenin, angiopoietin, and HGF in the EVs were measured by multiplex ELISA. Following treatment with thrombin and thrombin inhibition, EVs were isolated from the conditioned media of UCB-MSC cultures, and VEGF, angiogenin, angiopoietin, and HGF protein levels were assessed. An asterisk (*) indicates a significant difference vs. naive EVs, a number sign (#) indicates a significant difference vs. thrombin-treated UCB-MSC and a dollar sign ($) indicates a significant difference vs. thrombin + PAR3 siRNA UCB-MSC ( p < 0.05, two-sample t -test; n = 6 per analysis).

    Journal: International Journal of Molecular Sciences

    Article Title: Thrombin Preconditioning Boosts Biogenesis of Extracellular Vesicles from Mesenchymal Stem Cells and Enriches Their Cargo Contents via Protease-Activated Receptor-Mediated Signaling Pathways

    doi: 10.3390/ijms20122899

    Figure Lengend Snippet: Protease-activated receptors, PAR1 and PAR3, are involved in endosome production by umbilical cord-derived mesenchymal stem cells and protein cargo contents in extracellular vesicles after thrombin preconditioning. ( A ) After thrombin preconditioning of umbilical cord-derived mesenchymal stem cells (UCB-MSCs), the number of endosomes was determined by labeling early endosomes with green fluorescent protein(GFP-green) and the nuclei with 4′,6-Diamidino-2-Phenylindole, Dihydrochloride (DAPI-blue). ( B ) Bar graph showing the quantified intensities of the endosome-GFP signal. ( C ) After treatment with thrombin and thrombin inhibitor, the number of extracellular vesicles (EVs) was determined using a NanoSightNS300. ( D ) The size and number distribution of EVs as measured and analyzed by Nanoparticle Tracking Analysis software. ( E ) After treatment with thrombin and thrombin inhibitor, the levels of VEGF, angiogenin, angiopoietin, and HGF in the EVs were measured by multiplex ELISA. Following treatment with thrombin and thrombin inhibition, EVs were isolated from the conditioned media of UCB-MSC cultures, and VEGF, angiogenin, angiopoietin, and HGF protein levels were assessed. An asterisk (*) indicates a significant difference vs. naive EVs, a number sign (#) indicates a significant difference vs. thrombin-treated UCB-MSC and a dollar sign ($) indicates a significant difference vs. thrombin + PAR3 siRNA UCB-MSC ( p < 0.05, two-sample t -test; n = 6 per analysis).

    Article Snippet: Control and PAR3 siRNAs were purchased from Santa Cruz Biotechnology (Santa Cruz, CA, USA).

    Techniques: Derivative Assay, Labeling, Software, Multiplex Assay, Enzyme-linked Immunosorbent Assay, Inhibition, Isolation

    Par3 expression affects YAP subcellular translocation in MDCK cells. ( a ) Distribution and co-localization of YAP (red), Par3 (green), a merged image with only YAP and Par3 and a merged image with 4′, 6-diamidino-2-phenylindole (blue) of MDCK II cells at different cell densities. Scale bar: 25 μm. ( b ) Ratios of the percentages of nuclear and cytoplasmic YAP and Par3 at different cell densities are shown. Pictures were analyzed with a Columbus Image Data Storage and Analysis System. ( c ) Representative images of YAP translocation into the cytoplasm at low cell density when Par3 was knocked down but not at high cell density. MDCK II cells were transfected with siRNA for Par3 at different cell densities. YAP (red), Par3 (green) and a merged image. Scale bar: 25 μm. All pictures were taken with a Leica TCS SP5 microscope. ( d ) The areas representing the cytosolic or nuclear fraction are indicated with bars at the top of each histogram. N: nucleus; C: cytoplasm. The histogram analysis of YAP and Par3 signal intensity in subcellular distributions was performed with the ‘Plot profile’ in ImageJ software. The analyzed area is indicated by the white straight line in the overview. YAP signal intensity distribution (red line), nucleus signal intensity distribution (blue line). ( e , f ) YAP translocated into the nucleus with Par3 overexpression, and YAP nuclear localization was inhibited when Par3 was knocked down. A cell fraction assay was performed after 293T cells were transfected with Flag-Par3 or MDCK II cells were transfected with siRNA for Par3 for 2 days at low cell density. Lamin-B is the nuclear marker and β-actin is the cytoplasmic marker. ( g ) Par3 knockdown reduced YAP translocation to the nucleus in the Ca 2+ off switch system. Representative images of YAP translocation into the nucleus at high cell density when Ca 2+ was depleted are shown. After 2 days, while MDCK II cells were transfected with siRNA for Par3, MDCK II cells were cultured with Ca 2+ -free medium for the indicated time course. YAP (red), Par3 (green) and ZO-1 (purple). Scale bar: 25 μm. ( h ) Ratios of the percentages of nuclear and cytoplasmic YAP and Par3 at different time points. Pictures were analyzed with a Columbus Image Data Storage and Analysis System. ** P <0.01, * P <0.05.

    Journal: Cell Discovery

    Article Title: Dual function of partitioning-defective 3 in the regulation of YAP phosphorylation and activation

    doi: 10.1038/celldisc.2016.21

    Figure Lengend Snippet: Par3 expression affects YAP subcellular translocation in MDCK cells. ( a ) Distribution and co-localization of YAP (red), Par3 (green), a merged image with only YAP and Par3 and a merged image with 4′, 6-diamidino-2-phenylindole (blue) of MDCK II cells at different cell densities. Scale bar: 25 μm. ( b ) Ratios of the percentages of nuclear and cytoplasmic YAP and Par3 at different cell densities are shown. Pictures were analyzed with a Columbus Image Data Storage and Analysis System. ( c ) Representative images of YAP translocation into the cytoplasm at low cell density when Par3 was knocked down but not at high cell density. MDCK II cells were transfected with siRNA for Par3 at different cell densities. YAP (red), Par3 (green) and a merged image. Scale bar: 25 μm. All pictures were taken with a Leica TCS SP5 microscope. ( d ) The areas representing the cytosolic or nuclear fraction are indicated with bars at the top of each histogram. N: nucleus; C: cytoplasm. The histogram analysis of YAP and Par3 signal intensity in subcellular distributions was performed with the ‘Plot profile’ in ImageJ software. The analyzed area is indicated by the white straight line in the overview. YAP signal intensity distribution (red line), nucleus signal intensity distribution (blue line). ( e , f ) YAP translocated into the nucleus with Par3 overexpression, and YAP nuclear localization was inhibited when Par3 was knocked down. A cell fraction assay was performed after 293T cells were transfected with Flag-Par3 or MDCK II cells were transfected with siRNA for Par3 for 2 days at low cell density. Lamin-B is the nuclear marker and β-actin is the cytoplasmic marker. ( g ) Par3 knockdown reduced YAP translocation to the nucleus in the Ca 2+ off switch system. Representative images of YAP translocation into the nucleus at high cell density when Ca 2+ was depleted are shown. After 2 days, while MDCK II cells were transfected with siRNA for Par3, MDCK II cells were cultured with Ca 2+ -free medium for the indicated time course. YAP (red), Par3 (green) and ZO-1 (purple). Scale bar: 25 μm. ( h ) Ratios of the percentages of nuclear and cytoplasmic YAP and Par3 at different time points. Pictures were analyzed with a Columbus Image Data Storage and Analysis System. ** P <0.01, * P <0.05.

    Article Snippet: The sequences of the Par3 siRNA duplexes (siRNA1: GACAGACUGGUAGCAGUGU, siRNA2: CAUGGAGAUGGAGGAAUAC), LATS1/2 siRNA (LATS1 siRNA: CAUACGAGUCAAUCAGUAA, LATS2 siRNA: AAAGGCGUAUGGCGAGUAG) and PP1A siRNA (siRNA1: AAAACCTTCACTGACTGCTTC, siRNA2: CCATTCTTCTGGAGCTGGA) were synthesized by Genepharma (Shanghai, China).

    Techniques: Expressing, Translocation Assay, Transfection, Microscopy, Software, Over Expression, Marker, Knockdown, Cell Culture

    Par3 binds to the YAP PDZ-binding motif (PDZM) via its PDZ3 domain. ( a ) Par3 interacted with YAP. 293T cells were transiently transfected with the FLAG-Par3 and HA-YAP as indicated; co-immunoprecipitation (co-IP) and reverse-IP with anti-FLAG/HA antibodies were performed, and the cells were harvested for western blot analysis. ( b ) Endogenous Par3 bound to YAP in MDCK II cells. MDCK II cells were harvested and co-immunoprecipitated and reverse-immunoprecipitated with anti-Par3/YAP antibodies. ( c ) Modular structures of the three PDZ domain deletion mutations of Par3 and YAP. ( d, e ) Deletion of the Par3 PDZ3 eliminated its interaction with YAP. 293T cells were transfected with FLAG-Par3, FLAG-ΔPDZ1/2/3 mutants of Par3 and HA-YAP; co-IPs and reverse-IPs were conducted with anti-FLAG/HA antibodies. ( f ) Deletion of the PDZ motif of YAP also abrogated binding to Par3. 293T cells were transfected with FLAG-Par3, HA-YAP and HA-YAP/ΔPDZM; co-IPs were performed with anti-FLAG antibodies. ( g ) PDZ3 of Par3 was essential for the interaction, as determined by pull-down assay. 293T cells, which were transfected with HA-YAP, were lysed and incubated with glutathione-S-transferase (GST) and GST-tagged PDZ1/2/3 domains of Par3 bound to glutathione beads.

    Journal: Cell Discovery

    Article Title: Dual function of partitioning-defective 3 in the regulation of YAP phosphorylation and activation

    doi: 10.1038/celldisc.2016.21

    Figure Lengend Snippet: Par3 binds to the YAP PDZ-binding motif (PDZM) via its PDZ3 domain. ( a ) Par3 interacted with YAP. 293T cells were transiently transfected with the FLAG-Par3 and HA-YAP as indicated; co-immunoprecipitation (co-IP) and reverse-IP with anti-FLAG/HA antibodies were performed, and the cells were harvested for western blot analysis. ( b ) Endogenous Par3 bound to YAP in MDCK II cells. MDCK II cells were harvested and co-immunoprecipitated and reverse-immunoprecipitated with anti-Par3/YAP antibodies. ( c ) Modular structures of the three PDZ domain deletion mutations of Par3 and YAP. ( d, e ) Deletion of the Par3 PDZ3 eliminated its interaction with YAP. 293T cells were transfected with FLAG-Par3, FLAG-ΔPDZ1/2/3 mutants of Par3 and HA-YAP; co-IPs and reverse-IPs were conducted with anti-FLAG/HA antibodies. ( f ) Deletion of the PDZ motif of YAP also abrogated binding to Par3. 293T cells were transfected with FLAG-Par3, HA-YAP and HA-YAP/ΔPDZM; co-IPs were performed with anti-FLAG antibodies. ( g ) PDZ3 of Par3 was essential for the interaction, as determined by pull-down assay. 293T cells, which were transfected with HA-YAP, were lysed and incubated with glutathione-S-transferase (GST) and GST-tagged PDZ1/2/3 domains of Par3 bound to glutathione beads.

    Article Snippet: The sequences of the Par3 siRNA duplexes (siRNA1: GACAGACUGGUAGCAGUGU, siRNA2: CAUGGAGAUGGAGGAAUAC), LATS1/2 siRNA (LATS1 siRNA: CAUACGAGUCAAUCAGUAA, LATS2 siRNA: AAAGGCGUAUGGCGAGUAG) and PP1A siRNA (siRNA1: AAAACCTTCACTGACTGCTTC, siRNA2: CCATTCTTCTGGAGCTGGA) were synthesized by Genepharma (Shanghai, China).

    Techniques: Binding Assay, Transfection, Immunoprecipitation, Co-Immunoprecipitation Assay, Western Blot, Pull Down Assay, Incubation

    Par3 promotes YAP dephosphorylation and activation, regulating YAP target gene expression and cell proliferation. ( a ) Par3 reduced YAP phosphorylation at Ser127. 293T cells were transfected with FLAG-Par3 and HA-YAP, and the pYAP Ser127 site was detected. The data are representative of three independent experiments, *** P <0.001. ( b ) Par3 knockdown increased YAP phosphorylation at low cell density but not at high cell density. MDCK II cells were transfected with two different siRNAs for Par3 at low and high cell densities, and total YAP and pYAP Ser127 sites were detected. The data are representative of three independent experiments, *** P <0.001, ** P <0.01. ( c ) Par3 knockdown inhibited YAP target genes Ankrd1, Ctgf, Cyr61 and Inhba at low cell density but not at high cell density. RT-qPCR was performed in MDCK II cells transfected with siRNA for Par3 at low and high cell densities. ( d ) Par3 knockdown inhibited cell proliferation, whereas overexpression of YAP active forms and YAP S127A rescued the inhibition by Par3 knockdown in MDCK II cells. An MTT assay was performed in MDCK II cells, and Par3 and HA-YAP and YAP/S127A expression levels were determined by western blotting. ( e , f ) Deleted PDZ3 domain of Par3 could not reduce YAP phosphorylation and deleted PDZ motif of YAP could not be regulated by Par3. 293T cells were transfected with indicated plasmids. ( g ) The inhibition of YAP target genes ( Ankrd1, Ctgf, Cyr61, Diaph1 and Inhba ) by Par3 knockdown at low density could be partially rescued by Par3, but not by Par3 ΔPDZ3. RT-qPCR was performed in MDCK II cells transfected with siRNA for Par3 at low density.

    Journal: Cell Discovery

    Article Title: Dual function of partitioning-defective 3 in the regulation of YAP phosphorylation and activation

    doi: 10.1038/celldisc.2016.21

    Figure Lengend Snippet: Par3 promotes YAP dephosphorylation and activation, regulating YAP target gene expression and cell proliferation. ( a ) Par3 reduced YAP phosphorylation at Ser127. 293T cells were transfected with FLAG-Par3 and HA-YAP, and the pYAP Ser127 site was detected. The data are representative of three independent experiments, *** P <0.001. ( b ) Par3 knockdown increased YAP phosphorylation at low cell density but not at high cell density. MDCK II cells were transfected with two different siRNAs for Par3 at low and high cell densities, and total YAP and pYAP Ser127 sites were detected. The data are representative of three independent experiments, *** P <0.001, ** P <0.01. ( c ) Par3 knockdown inhibited YAP target genes Ankrd1, Ctgf, Cyr61 and Inhba at low cell density but not at high cell density. RT-qPCR was performed in MDCK II cells transfected with siRNA for Par3 at low and high cell densities. ( d ) Par3 knockdown inhibited cell proliferation, whereas overexpression of YAP active forms and YAP S127A rescued the inhibition by Par3 knockdown in MDCK II cells. An MTT assay was performed in MDCK II cells, and Par3 and HA-YAP and YAP/S127A expression levels were determined by western blotting. ( e , f ) Deleted PDZ3 domain of Par3 could not reduce YAP phosphorylation and deleted PDZ motif of YAP could not be regulated by Par3. 293T cells were transfected with indicated plasmids. ( g ) The inhibition of YAP target genes ( Ankrd1, Ctgf, Cyr61, Diaph1 and Inhba ) by Par3 knockdown at low density could be partially rescued by Par3, but not by Par3 ΔPDZ3. RT-qPCR was performed in MDCK II cells transfected with siRNA for Par3 at low density.

    Article Snippet: The sequences of the Par3 siRNA duplexes (siRNA1: GACAGACUGGUAGCAGUGU, siRNA2: CAUGGAGAUGGAGGAAUAC), LATS1/2 siRNA (LATS1 siRNA: CAUACGAGUCAAUCAGUAA, LATS2 siRNA: AAAGGCGUAUGGCGAGUAG) and PP1A siRNA (siRNA1: AAAACCTTCACTGACTGCTTC, siRNA2: CCATTCTTCTGGAGCTGGA) were synthesized by Genepharma (Shanghai, China).

    Techniques: De-Phosphorylation Assay, Activation Assay, Targeted Gene Expression, Phospho-proteomics, Transfection, Knockdown, Quantitative RT-PCR, Over Expression, Inhibition, MTT Assay, Expressing, Western Blot

    Par3 interacts with LATS1/2, YAP and PP1A and promotes dephosphorylation of LATS1 and YAP. ( a ) Overexpression of Par3 and PDZ deletion mutants decreased LATS1 phosphorylation at Ser909. 293T cells were transfected with the indicated plasmids, and pLATS Ser909 was determined by western blotting. ( b ) The reduction of YAP phosphorylation by Par3 overexpression was weakened when LATS1/2 was knocked down. 293T cells were transfected with FLAG-Par3 and siRNA for LATS1/2; western blot analysis was performed as indicated. ( c ) The increment of YAP phosphorylation by Par3 knockdown was attenuated by LATS1/2 knockdown. MDCK II cells were transfected with siRNA for Par3 or LATS1/2; western blot analysis was performed as indicated. ( d ) Par3 interacted with LATS1 and PP1A. Co-immunoprecipitation was conducted with anti-FLAG antibodies in 293T cells, which were transfected with GFP-Par3, FLAG-LATS1 and FLAG-PP1A. ( e ) Par3 promoted the interaction of YAP and PP1A. IP was conducted with anti-YAP antibodies in 293T cells transfected with FLAG-Par3, and endogenous PP1A was subjected to western blot analysis. ( f ) Par3 knockdown reduced the interaction of LATS1 and PP1A. IP was performed with anti-LATS1 antibodies in 293T cells transfected with siPar3, and western blot analysis was performed as indicated. All experiments were performed at low cell density. ( g ) LATS1 and PP1A mainly localized in the nucleus at a low cell density. Cell fractionations were performed with MDCK II cells at low cell density. Western blot analysis was performed as indicated. ( h ) YAP interacts with Par3, LATS1 and PP1A in the nucleus and cytoplasm. IP with anti-YAP antibodies was conducted with the nuclear and cytoplasmic fractions of MDCK II cells at low cell density. Western blot analysis was performed as indicated.

    Journal: Cell Discovery

    Article Title: Dual function of partitioning-defective 3 in the regulation of YAP phosphorylation and activation

    doi: 10.1038/celldisc.2016.21

    Figure Lengend Snippet: Par3 interacts with LATS1/2, YAP and PP1A and promotes dephosphorylation of LATS1 and YAP. ( a ) Overexpression of Par3 and PDZ deletion mutants decreased LATS1 phosphorylation at Ser909. 293T cells were transfected with the indicated plasmids, and pLATS Ser909 was determined by western blotting. ( b ) The reduction of YAP phosphorylation by Par3 overexpression was weakened when LATS1/2 was knocked down. 293T cells were transfected with FLAG-Par3 and siRNA for LATS1/2; western blot analysis was performed as indicated. ( c ) The increment of YAP phosphorylation by Par3 knockdown was attenuated by LATS1/2 knockdown. MDCK II cells were transfected with siRNA for Par3 or LATS1/2; western blot analysis was performed as indicated. ( d ) Par3 interacted with LATS1 and PP1A. Co-immunoprecipitation was conducted with anti-FLAG antibodies in 293T cells, which were transfected with GFP-Par3, FLAG-LATS1 and FLAG-PP1A. ( e ) Par3 promoted the interaction of YAP and PP1A. IP was conducted with anti-YAP antibodies in 293T cells transfected with FLAG-Par3, and endogenous PP1A was subjected to western blot analysis. ( f ) Par3 knockdown reduced the interaction of LATS1 and PP1A. IP was performed with anti-LATS1 antibodies in 293T cells transfected with siPar3, and western blot analysis was performed as indicated. All experiments were performed at low cell density. ( g ) LATS1 and PP1A mainly localized in the nucleus at a low cell density. Cell fractionations were performed with MDCK II cells at low cell density. Western blot analysis was performed as indicated. ( h ) YAP interacts with Par3, LATS1 and PP1A in the nucleus and cytoplasm. IP with anti-YAP antibodies was conducted with the nuclear and cytoplasmic fractions of MDCK II cells at low cell density. Western blot analysis was performed as indicated.

    Article Snippet: The sequences of the Par3 siRNA duplexes (siRNA1: GACAGACUGGUAGCAGUGU, siRNA2: CAUGGAGAUGGAGGAAUAC), LATS1/2 siRNA (LATS1 siRNA: CAUACGAGUCAAUCAGUAA, LATS2 siRNA: AAAGGCGUAUGGCGAGUAG) and PP1A siRNA (siRNA1: AAAACCTTCACTGACTGCTTC, siRNA2: CCATTCTTCTGGAGCTGGA) were synthesized by Genepharma (Shanghai, China).

    Techniques: De-Phosphorylation Assay, Over Expression, Phospho-proteomics, Transfection, Western Blot, Knockdown, Immunoprecipitation

    Dual function of Par3 in regulating YAP phosphorylation and activation . ( a ) PP1A knockdown alone increased YAP and LATS1 phosphorylation, and PP1A knockdown plus Par3 overexpression promoted more the increased phosphorylation of YAP and LATS1. 293T cells were transfected with two different siRNAs for PP1A and FLAG-Par3 plasmids. Western blot analysis was performed as indicated. ( b ) PP1A knockdown inhibited YAP target genes Anln, Ankrd1, Ctgf and Diaph1 , and Par3 overexpression enhanced the inhibition of YAP target genes by PP1A knockdown. RT-qPCR was performed in 293T cells transfected with siRNA for PP1A and FLAG-Par3 at low cell density. ( c ) PP1A knockdown inhibited cell proliferation, and Par3 overexpression enhanced the inhibition of cell proliferation by PP1A knockdown, as assessed by an EdU assay. Total cell number was measured by 4′, 6-diamidino-2-phenylindole (blue), and cells in mitosis were labeled by EdU (green). Scale bar: 100 um. MDCK II cells were transfected with siRNA for PP1A and FLAG-Par3 plasmids for 2 days and were then cultured with normal medium containing 10 μ M EdU for 30 min. Cells were then stained according to the Click-iT EdU Alexa Fluor 488 Imaging Kit (C10337) protocol from Invitrogen. ( d ) The ratio of EdU-positive cells/total cells was determined.

    Journal: Cell Discovery

    Article Title: Dual function of partitioning-defective 3 in the regulation of YAP phosphorylation and activation

    doi: 10.1038/celldisc.2016.21

    Figure Lengend Snippet: Dual function of Par3 in regulating YAP phosphorylation and activation . ( a ) PP1A knockdown alone increased YAP and LATS1 phosphorylation, and PP1A knockdown plus Par3 overexpression promoted more the increased phosphorylation of YAP and LATS1. 293T cells were transfected with two different siRNAs for PP1A and FLAG-Par3 plasmids. Western blot analysis was performed as indicated. ( b ) PP1A knockdown inhibited YAP target genes Anln, Ankrd1, Ctgf and Diaph1 , and Par3 overexpression enhanced the inhibition of YAP target genes by PP1A knockdown. RT-qPCR was performed in 293T cells transfected with siRNA for PP1A and FLAG-Par3 at low cell density. ( c ) PP1A knockdown inhibited cell proliferation, and Par3 overexpression enhanced the inhibition of cell proliferation by PP1A knockdown, as assessed by an EdU assay. Total cell number was measured by 4′, 6-diamidino-2-phenylindole (blue), and cells in mitosis were labeled by EdU (green). Scale bar: 100 um. MDCK II cells were transfected with siRNA for PP1A and FLAG-Par3 plasmids for 2 days and were then cultured with normal medium containing 10 μ M EdU for 30 min. Cells were then stained according to the Click-iT EdU Alexa Fluor 488 Imaging Kit (C10337) protocol from Invitrogen. ( d ) The ratio of EdU-positive cells/total cells was determined.

    Article Snippet: The sequences of the Par3 siRNA duplexes (siRNA1: GACAGACUGGUAGCAGUGU, siRNA2: CAUGGAGAUGGAGGAAUAC), LATS1/2 siRNA (LATS1 siRNA: CAUACGAGUCAAUCAGUAA, LATS2 siRNA: AAAGGCGUAUGGCGAGUAG) and PP1A siRNA (siRNA1: AAAACCTTCACTGACTGCTTC, siRNA2: CCATTCTTCTGGAGCTGGA) were synthesized by Genepharma (Shanghai, China).

    Techniques: Phospho-proteomics, Activation Assay, Knockdown, Over Expression, Transfection, Western Blot, Inhibition, Quantitative RT-PCR, EdU Assay, Labeling, Cell Culture, Staining, Imaging

    YAP activation by Par3 is differentially regulated in tumor cell lines . ( a ) Par3, YAP and PP1A expression patterns were different in different cell lines. The lung cell lines A549, 5810, 5844, 5883, 5928 and HepG2 were harvested for western blotting, and analyses were performed as indicated. ( b ) In the 5928 cell line, Par3 decreases YAP phosphorylation, as in 293T cells. 5928 cells were transfected with FLAG-Par3, and pYAP Ser127 was detected. ( c ) The YAP target genes Anln, Ankrd1, Ctgf and Cyr61 were upregulated when Par3 was overexpressed. RT-qPCR was performed in 5928 cells transfected with FLAG-Par3 at low cell density. ( d ) In the 5803 cell line, Par3 increased YAP phosphorylation and reduced YAP protein levels. 5803 cells were transfected with FLAG-Par3, and pYAP Ser127 and YAP were detected. ( e ) The YAP target genes Ankrd1, Cyr61, Diaph1 and Inhba were reduced when Par3 was overexpressed in the 5803 cell line. RT-qPCR was performed in 5803 cells transfected with FLAG-Par3 at low cell density.

    Journal: Cell Discovery

    Article Title: Dual function of partitioning-defective 3 in the regulation of YAP phosphorylation and activation

    doi: 10.1038/celldisc.2016.21

    Figure Lengend Snippet: YAP activation by Par3 is differentially regulated in tumor cell lines . ( a ) Par3, YAP and PP1A expression patterns were different in different cell lines. The lung cell lines A549, 5810, 5844, 5883, 5928 and HepG2 were harvested for western blotting, and analyses were performed as indicated. ( b ) In the 5928 cell line, Par3 decreases YAP phosphorylation, as in 293T cells. 5928 cells were transfected with FLAG-Par3, and pYAP Ser127 was detected. ( c ) The YAP target genes Anln, Ankrd1, Ctgf and Cyr61 were upregulated when Par3 was overexpressed. RT-qPCR was performed in 5928 cells transfected with FLAG-Par3 at low cell density. ( d ) In the 5803 cell line, Par3 increased YAP phosphorylation and reduced YAP protein levels. 5803 cells were transfected with FLAG-Par3, and pYAP Ser127 and YAP were detected. ( e ) The YAP target genes Ankrd1, Cyr61, Diaph1 and Inhba were reduced when Par3 was overexpressed in the 5803 cell line. RT-qPCR was performed in 5803 cells transfected with FLAG-Par3 at low cell density.

    Article Snippet: The sequences of the Par3 siRNA duplexes (siRNA1: GACAGACUGGUAGCAGUGU, siRNA2: CAUGGAGAUGGAGGAAUAC), LATS1/2 siRNA (LATS1 siRNA: CAUACGAGUCAAUCAGUAA, LATS2 siRNA: AAAGGCGUAUGGCGAGUAG) and PP1A siRNA (siRNA1: AAAACCTTCACTGACTGCTTC, siRNA2: CCATTCTTCTGGAGCTGGA) were synthesized by Genepharma (Shanghai, China).

    Techniques: Activation Assay, Expressing, Western Blot, Phospho-proteomics, Transfection, Quantitative RT-PCR

    The hypothetical model for the dual function of Par3 in regulating YAP phosphorylation and activation. At high cell density, Par3 and YAP co-localize in the TJs at the cell–cell contact and Par3 has no effect on YAP phosphorylation (left panel). At low cell density, or calcium depletion, HGF stimulation/γ-irradiation, phosphorylated Par3 by Par1 translocates from membrane to the cytoplasm(①) or the nucleus (②). Cytoplasmic or nuclear Par3 recruits PP1A to dephosphorylate LATS1, promoting YAP activity (right panel). When PP1A is knocked down or Par3’s spatial localization is disordered, Par3 expression induces YAP hyperphosphorylation and degradation (③).

    Journal: Cell Discovery

    Article Title: Dual function of partitioning-defective 3 in the regulation of YAP phosphorylation and activation

    doi: 10.1038/celldisc.2016.21

    Figure Lengend Snippet: The hypothetical model for the dual function of Par3 in regulating YAP phosphorylation and activation. At high cell density, Par3 and YAP co-localize in the TJs at the cell–cell contact and Par3 has no effect on YAP phosphorylation (left panel). At low cell density, or calcium depletion, HGF stimulation/γ-irradiation, phosphorylated Par3 by Par1 translocates from membrane to the cytoplasm(①) or the nucleus (②). Cytoplasmic or nuclear Par3 recruits PP1A to dephosphorylate LATS1, promoting YAP activity (right panel). When PP1A is knocked down or Par3’s spatial localization is disordered, Par3 expression induces YAP hyperphosphorylation and degradation (③).

    Article Snippet: The sequences of the Par3 siRNA duplexes (siRNA1: GACAGACUGGUAGCAGUGU, siRNA2: CAUGGAGAUGGAGGAAUAC), LATS1/2 siRNA (LATS1 siRNA: CAUACGAGUCAAUCAGUAA, LATS2 siRNA: AAAGGCGUAUGGCGAGUAG) and PP1A siRNA (siRNA1: AAAACCTTCACTGACTGCTTC, siRNA2: CCATTCTTCTGGAGCTGGA) were synthesized by Genepharma (Shanghai, China).

    Techniques: Phospho-proteomics, Activation Assay, Irradiation, Membrane, Activity Assay, Expressing